View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_79 (Length: 246)
Name: NF13061_low_79
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_79 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 34942938 - 34942711
Alignment:
| Q |
1 |
acaacgattgaggaaatgggaataacaacaagtcttgtaggatatagatgagattaaaaatatattctgataatcttctttttacataactatctatgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34942938 |
acaacgattgaggaaatgggaataacaacaagtcttgtaggatatagatgagattaaaaatatattctgataatcttctttttacataactatctaagaa |
34942839 |
T |
 |
| Q |
101 |
agttattagacaaatgtgtccaattgtctcaacaaaattatattctcatgcagcagatattgcattttgcagtttttgtctttcaacgccacccaccaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34942838 |
agttattagacaaatgtgtccaattgtctcaacaaaattatattctcatgcagcagatattgcattttgcagtttttgtctttcaacgccacccaccaac |
34942739 |
T |
 |
| Q |
201 |
tgttttttcctatatttaacaggaacta |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||| |
|
|
| T |
34942738 |
tgttttttcccatatttaacaggaacta |
34942711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University