View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_83 (Length: 240)
Name: NF13061_low_83
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 21658128 - 21658330
Alignment:
| Q |
22 |
gtaggtttgactttttcttctataagctcagattcatgatcataagagatcttcacattcaccaaagttttattctctgatattgctgagaattgaaaag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21658128 |
gtaggtttgactttttcttctataagctcagattcatgatcataagagatcttcacattcaccaaagttttattctctgatattgctgagaattggaaag |
21658227 |
T |
|
| Q |
122 |
ttgtcttgtagtatgacaacccttgattcagatagcctccttcaaccacttggagcccaattgtatgagataactcatcatactcagtgatcacctccct |
221 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21658228 |
ttgtcttgtagtatgacaagccttgattcagatagcctccttcaaccacttggagcccaattgtatgagataactcatcatactcagtgatcacctccct |
21658327 |
T |
|
| Q |
222 |
ttg |
224 |
Q |
| |
|
||| |
|
|
| T |
21658328 |
ttg |
21658330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University