View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13061_low_86 (Length: 231)
Name: NF13061_low_86
Description: NF13061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13061_low_86 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 3 - 64
Target Start/End: Complemental strand, 28737446 - 28737385
Alignment:
| Q |
3 |
tgggaagcgcttttgcatttggctttttggttacgatttacataacaaaataatcaattgtc |
64 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28737446 |
tgggaagcacttttgcatttggctttttggttacgatttacataacaaaataatcaattgtc |
28737385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University