View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13062_high_10 (Length: 263)
Name: NF13062_high_10
Description: NF13062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13062_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 23 - 247
Target Start/End: Complemental strand, 30808376 - 30808153
Alignment:
| Q |
23 |
cgaaagaatgtactcgagttgatcgacctgaatgtgattttttacatttgagttttgcgggttcggacgaacaggtatttgtccacccctagttgttggg |
122 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
30808376 |
cgaaagaatgtactcgagttgatcggcctgaatgtgattttttacatttgagttttgcgggttccgacgaacaggtatttgtccaccc-tacttgttggg |
30808278 |
T |
 |
| Q |
123 |
tttttcgcggacttttgtatcctgggtcaaagcctggaagttccttaacagaaaaatgaagcatgtggcgttaaaacttttctgagtacgcgtacaacac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30808277 |
tttttcgcggacttttgtatcctgggtcaaagcctggaagttccttaacagaaaaatgaagcatgtggcgttagaacttttctgagtacgcgtacaacac |
30808178 |
T |
 |
| Q |
223 |
atggacaattgtcttgctttcattg |
247 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30808177 |
atggacaattgtcttgctttcattg |
30808153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University