View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13062_high_11 (Length: 249)
Name: NF13062_high_11
Description: NF13062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13062_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 1325191 - 1324973
Alignment:
| Q |
17 |
ataaagggtggaagattattactagtgattattttctctcttccttgacattaattaggttgaactttgtccaaaaatttgtcaatgtctatttatactt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1325191 |
ataaagggtggaagattattactagtgattattttctctcttccttgacattaattaggttgaactttgtccaaaaatttgtcaatgtctatttatactt |
1325092 |
T |
 |
| Q |
117 |
ggattgatggtgattgtggaagaattacggtctattattgcgactttaacaaaaactactttttaaaattcaacaaaaccgcagttctgtcataggtacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1325091 |
ggattgatggtgattgtggaagaattacagtctattattgcgactttaacaaaaactactttttaaaattcaacaaaaccgcagttttgtcataggtacc |
1324992 |
T |
 |
| Q |
217 |
gttaatccaatcatgcact |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1324991 |
gttaatccaatcatgcact |
1324973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University