View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13062_high_7 (Length: 327)
Name: NF13062_high_7
Description: NF13062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13062_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 321
Target Start/End: Original strand, 10004324 - 10004627
Alignment:
| Q |
18 |
atagctttcaaattgaatttggctaaactctcagactgggcagatgggtcaacttccatttgttgtccttgccggcagtaactaactatcggaatctcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10004324 |
atagctttcaaattgaatttggctaaactctcagactgggcagatgggtcaacttccatttgttgtccttgccggcagtaactaactatcggaatctcta |
10004423 |
T |
|
| Q |
118 |
tattctacaataaaacatttaaatgaagatacagtaaaaattaaaacaatagtaccaacacaaactgtcgtcccttatgtcttcagtataattaaaagaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10004424 |
tattctacaataaaacatttaaatgaagatacagtaaaaattaaaacaatagtaccaacacaaacggtcgtcccttatgtcttcagtataattaaaagaa |
10004523 |
T |
|
| Q |
218 |
aatgcaggttgtgtaacttacatccttgccttcattcagcgattgtgaaagaaaagctatagatctggaattagcagtctgggttaaaacaagaacatct |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10004524 |
aatgcaggttgtgtaacgtacatccttgccttcattcagcgattgtgaaagaaaagctatagatctggaattagcagtctgggttaaaacaagaacatct |
10004623 |
T |
|
| Q |
318 |
ctgc |
321 |
Q |
| |
|
|||| |
|
|
| T |
10004624 |
ctgc |
10004627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University