View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13062_low_13 (Length: 238)
Name: NF13062_low_13
Description: NF13062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13062_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 222
Target Start/End: Original strand, 12051597 - 12051803
Alignment:
| Q |
16 |
atggaaaaattggtgagagatgggaatgaagagtttgtaagaaagcaagataagcttggtcacacagctcttgctcttgcagcttgttataatgctaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12051597 |
atggaaaaattggtgagagatgggaatgaagagtttgtaagaaagcaagataagcttggtcacacagctcttgctcttgcagcttgttataatgctaaaa |
12051696 |
T |
|
| Q |
116 |
ttgctatagtagagcgcatgctacaagttgtagacaacaacataggggaggagctgctgatgcagccgaacacaaaaggagaaatcccgattctattagc |
215 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12051697 |
tcgctatagtagagcacatgctacaagttgtagacaacaacataggggaggagctgctgatgcagccgaacacaaaaggagaaatcccgattctattagc |
12051796 |
T |
|
| Q |
216 |
tgctgct |
222 |
Q |
| |
|
||||||| |
|
|
| T |
12051797 |
tgctgct |
12051803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 25 - 125
Target Start/End: Complemental strand, 12114740 - 12114640
Alignment:
| Q |
25 |
ttggtgagagatgggaatgaagagtttgtaagaaagcaagataagcttggtcacacagctcttgctcttgcagcttgttataatgctaaaattgctatag |
124 |
Q |
| |
|
||||||||||| |||| || |||||||||| ||||||||||| | ||| |||||||||||||||||||||||||||||||||| ||||| | ||||| |
|
|
| T |
12114740 |
ttggtgagagaagggagagatgagtttgtaacaaagcaagataggtatggggacacagctcttgctcttgcagcttgttataatgcaaaaatagatatag |
12114641 |
T |
|
| Q |
125 |
t |
125 |
Q |
| |
|
| |
|
|
| T |
12114640 |
t |
12114640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 110
Target Start/End: Complemental strand, 12093992 - 12093907
Alignment:
| Q |
25 |
ttggtgagagatgggaatgaagagtttgtaagaaagcaagataagcttggtcacacagctcttgctcttgcagcttgttataatgc |
110 |
Q |
| |
|
||||||||||| |||| || |||||||||| ||||||||||| || || | |||||||| ||||||||||||| ||||||||| |
|
|
| T |
12093992 |
ttggtgagagaagggagggatgagtttgtaacaaagcaagataggcacggggatacagctctggctcttgcagcttattataatgc |
12093907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University