View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13062_low_15 (Length: 227)
Name: NF13062_low_15
Description: NF13062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13062_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 43952339 - 43952565
Alignment:
| Q |
1 |
caaaaacccacaacctcaaattcgattaaccaaaatgctctctggctgcaaacatcctaaaacaccatctttttccttagataacggcagaaacatatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952339 |
caaaaacccacaacctcaaattcgattaaccaaaatgctctctggctgcaaacatcctaaaacaccatctttttccttagataacggcagaaacatatca |
43952438 |
T |
 |
| Q |
101 |
tcctctaacgccgttaacaacaataacaacaaaatcaatgatgctgcaacactagctgacgttgaccgttttctctttgagaatttcaagtctctatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952439 |
tcctctaacgccgttaacaacaataacaacaaaatcaatgatgctgcaacactagctgacgttgaccgttttctctttgagaatttcaagtctctatatt |
43952538 |
T |
 |
| Q |
201 |
tcaaagatgacgaagaaacagaacaaa |
227 |
Q |
| |
|
|||||||||| |||||||||||||||| |
|
|
| T |
43952539 |
tcaaagatgatgaagaaacagaacaaa |
43952565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 149 - 217
Target Start/End: Complemental strand, 3236178 - 3236110
Alignment:
| Q |
149 |
acactagctgacgttgaccgttttctctttgagaatttcaagtctctatatttcaaagatgacgaagaa |
217 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |||| || |||||||| ||||| |
|
|
| T |
3236178 |
acactagaagacgttgaccgttttctcttcgagaatttcaagtctttatacctcgaagatgacaaagaa |
3236110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University