View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13062_low_4 (Length: 405)
Name: NF13062_low_4
Description: NF13062
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13062_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 168 - 307
Target Start/End: Original strand, 19419662 - 19419801
Alignment:
| Q |
168 |
atctggctgaaagcgaagttcgtgggagcgaagatggttagggagcgagattgacggcgagcgatgagagaatgggaagcgagttcgaggttgagtgcca |
267 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419662 |
atctggctgaaagcgaagttcgtcggagcgaagatggttagggagcgagattgacggcgagcgatgagagaatgggaagcgagttcgaggttgagtgcca |
19419761 |
T |
|
| Q |
268 |
tggcttcgtgaccggcggtggtgaggatttcggcggcatc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419762 |
tggcttcgtgaccggcggtggtgaggatttcggcggcatc |
19419801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 18 - 90
Target Start/End: Original strand, 19419512 - 19419584
Alignment:
| Q |
18 |
agtttacggtcggaagtagttgtgacggtgagggagtgaccggggagaagagtagcgatattcgcgccgaacg |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19419512 |
agtttacggtcggaagtagttgtgacggtgagggagtgaccggggagaagagtagcgacattcgcgccgaacg |
19419584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University