View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13064_low_17 (Length: 294)
Name: NF13064_low_17
Description: NF13064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13064_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 24 - 232
Target Start/End: Original strand, 11329197 - 11329405
Alignment:
| Q |
24 |
tatcgactactgagattgaaatgaatggatattgatgccaagacaatagcagtaaataactaaatactcctatgcttagtatataaatggagtgatattg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11329197 |
tatcgactactgagattgaaatgaatggatattgatgcaaagacaatagcagtaaataactaaatactcctatgcttagtatataaatggagtgatattg |
11329296 |
T |
 |
| Q |
124 |
agtatatagtaagctttgtttggtcacaatttcaaatgaaaaatatttagacaaacacacaaattnnnnnnntgtgacaaagcttttctagtttaaaaga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11329297 |
agtatatagtaagctttgtttggtcacaatttcaaatgaaaaatatttagacaaacacacaaattaaaaaaatgtgacaaagcttttctagtttaaaaga |
11329396 |
T |
 |
| Q |
224 |
atttcatgt |
232 |
Q |
| |
|
||||||||| |
|
|
| T |
11329397 |
atttcatgt |
11329405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University