View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13064_low_21 (Length: 237)
Name: NF13064_low_21
Description: NF13064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13064_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 20428495 - 20428275
Alignment:
| Q |
1 |
cctatcatcgaaggccttatccatgaatttatacaagcaccccaacaaagataagggtctaaaatgataaaggtggtataattagtctactttagttata |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20428495 |
cctatcatcgaagaccttatccatgaatttatacaagcaccccaacaaagatatgggtctaaaatgataaaggtggtataattagtctactttagttata |
20428396 |
T |
 |
| Q |
101 |
atagtaagaaaataagagtagaaaatttgtgcaagtatagcattactatcgaattgatcaaattaaccctacctttgaattggtcaaatataacctctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20428395 |
atagtaagaaaataagagtagaaaatttatgcaagtatagcattactatcgaattgatcaaattaaccctacctgtgaattggtcaaatataacctctca |
20428296 |
T |
 |
| Q |
201 |
tcctataataaccttaggaag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
20428295 |
tcctataataaccttaggaag |
20428275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University