View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13064_low_4 (Length: 562)
Name: NF13064_low_4
Description: NF13064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13064_low_4 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 77; Significance: 2e-35; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 423 - 562
Target Start/End: Original strand, 3175274 - 3175411
Alignment:
| Q |
423 |
tggaagtttgaaatccatatgcaaacatatgttgaatattaaagatacaaagcaacgaacttgatattgagataaaagtataatgttcttttttattttg |
522 |
Q |
| |
|
|||||| |||||||||||||||||||||| | ||||| |||||||||| ||||||||||||| |||||||||||| |||| || |||||| |||| |
|
|
| T |
3175274 |
tggaagattgaaatccatatgcaaacatagatgaaatatcaaagatacaatgcaacgaacttgagattgagataaaaatatagcgtgcttttt--ttttt |
3175371 |
T |
 |
| Q |
523 |
ttgttcaaagagacgatacaacgtgcttataaatatataa |
562 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3175372 |
ttgttcaaagagacgatacaacgtgcttataaatatataa |
3175411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University