View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13066_low_4 (Length: 277)
Name: NF13066_low_4
Description: NF13066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13066_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 142 - 259
Target Start/End: Complemental strand, 41818640 - 41818523
Alignment:
| Q |
142 |
actatgcaccatgtactgttacaatgaccttatacaaatttacatgtttatatggcttgctgaaaatttcataacctacatttccataatgaaagttatt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41818640 |
actatgcaccatgtactgttacaatgaccttatacaaatttacatgtttatatggcttgctgaaaatttcataacctacatttccataatgaaagttatt |
41818541 |
T |
 |
| Q |
242 |
gagtttaatccactatgg |
259 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41818540 |
gagtttaatccactatgg |
41818523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 13 - 93
Target Start/End: Complemental strand, 41825358 - 41825278
Alignment:
| Q |
13 |
aatatattttggtgtaggcttggctttctggattagcatgggcaccttgggtgagtaaaattgataactttctatatcaag |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41825358 |
aatatattttggtgtaggcttggctttctggattagcatgggcaccttgggtgagtaaaattaataactttctatatcaag |
41825278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 13 - 93
Target Start/End: Complemental strand, 41818768 - 41818689
Alignment:
| Q |
13 |
aatatattttggtgtaggcttggctttctggattagcatgggcaccttgggtgagtaaaattgataactttctatatcaag |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
41818768 |
aatatattttggtgtaggcttggctttctggattagcatgggcaccttgggtgagtaaaattg-tgactttctatatcaag |
41818689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 146 - 224
Target Start/End: Complemental strand, 41825152 - 41825074
Alignment:
| Q |
146 |
tgcaccatgtactgttacaatgaccttatacaaatttacatgtttatatggcttgctgaaaatttcataacctacattt |
224 |
Q |
| |
|
|||| |||||||||||||||| | ||| |||||||||||| ||||| || |||||||||||||||||| || ||||| |
|
|
| T |
41825152 |
tgcatcatgtactgttacaatatgcctattcaaatttacatgcttatagggtttgctgaaaatttcataatcttcattt |
41825074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University