View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13066_low_6 (Length: 237)
Name: NF13066_low_6
Description: NF13066
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13066_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 1156710 - 1156491
Alignment:
| Q |
1 |
tgttatgttataggagagtagaggctgcaannnnnnnnatgtattttgtgattgctagtgtggggctcaggcgttaatttttcagccttgcttgtgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1156710 |
tgttatgttataggagagtagaggctgcaattttttt-atgtaatttgtgattgctagtgtggggcttaggcgttaatttttcagccttgcttgtgtttc |
1156612 |
T |
 |
| Q |
101 |
ttctgttcctgtgtacctgtggcttttgccaagcacaacatctcaacttgtgatgtttttgctattggaataaattttggctattttnnnnnnngttcaa |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1156611 |
ttctgttcctgtgtacttgtggcttttgccaagcacaacatctcagcttgtgatgtttttgctattggaataaattttggctattttaaaaaaagttcaa |
1156512 |
T |
 |
| Q |
201 |
ttcactctttgatatatagat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1156511 |
ttcactctttgatatatagat |
1156491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 39 - 221
Target Start/End: Complemental strand, 1180851 - 1180669
Alignment:
| Q |
39 |
atgtattttgtgattgctagtgtggggctcaggcgttaatttttcagccttgcttgtgtttcttctgttcctgtgtacctgtggcttttgccaagcacaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1180851 |
atgtattttgtgattgctagtgtggggcttaggcgttaatttttcagccttgcctgtgtttcttctgttcctgtgtacttgtggcttttgccaagcacaa |
1180752 |
T |
 |
| Q |
139 |
catctcaacttgtgatgtttttgctattggaataaattttggctattttnnnnnnngttcaattcactctttgatatatagat |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1180751 |
catctcagcttgtgatgtttttgctattggaataaattttggctattttaaaaaaaaatcaattcactctttgatatatagat |
1180669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University