View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13067_high_10 (Length: 403)
Name: NF13067_high_10
Description: NF13067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13067_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 7e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 48548721 - 48548510
Alignment:
| Q |
19 |
gagaaggagcgggaacattatcctcaacgtgaacttctttcttcttagcttcttctttttgaatattcaactgtgtgataaa---ttgttaggttttcat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48548721 |
gagaaggagcgggaacattatcctcaacgtgaacttctttcttcttagcttcttctttttgaatattcaactgtgtgataaacaattgttaggttttcat |
48548622 |
T |
 |
| Q |
116 |
tgcttgaagaaaattgaacgaagaagcataaggtatagttagttacgagaatggcatcaatatcgtcttcgggagaaagcnnnnnnncttccctgcgagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
48548621 |
tgcttgaagaaaattgaacgaagaagcataaggtatagttagttacgagaatggcatcaatatcgtcttcgggagaaagctttttttcctccctgcgagc |
48548522 |
T |
 |
| Q |
216 |
tcgtttcatatc |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48548521 |
tcgtttcatatc |
48548510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 341 - 396
Target Start/End: Complemental strand, 48548384 - 48548329
Alignment:
| Q |
341 |
gaaatcaaatgtagaattgaaatgatgtttttgcactcactctcgcccttcttctc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48548384 |
gaaatcaaatgtagaattgaaatgatgtttttgcactcactctcgcccttcttctc |
48548329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University