View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13067_high_20 (Length: 282)
Name: NF13067_high_20
Description: NF13067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13067_high_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 266
Target Start/End: Complemental strand, 27565578 - 27565333
Alignment:
| Q |
20 |
ttgcaccatgtttatatataaagagaagtcaccactaaaaaatatatataaagaggtaaagatgtgctatggatcacatggggtggcatatataaacttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27565578 |
ttgcaccatgtttatatataaagagaagtcaccactaaaaaatatatataaagaggtaaagatgtgctatggatcacatggggtggcatatataaacttt |
27565479 |
T |
|
| Q |
120 |
atttttcaacgagcagaataagaaaaagggggctataaataagacagtaaaaagattgctttcttttgtcagtatgctttttgtatacatggcttccact |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27565478 |
atttttcaacgagcagaataagaaaaagggag-tataaataagacagtaaaaagattgctttcttttgtcagtatgctttttgtatacatggcttccact |
27565380 |
T |
|
| Q |
220 |
aatgggaaatattctctccatgtgtttggtagtaacagggaagcttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27565379 |
aatgggaaatattctctccatgtgtttggtagtaacagggaagcttg |
27565333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University