View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13067_low_22 (Length: 280)
Name: NF13067_low_22
Description: NF13067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13067_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 262
Target Start/End: Original strand, 47515278 - 47515522
Alignment:
| Q |
18 |
gaacataagcaccaagtactgcctcagacaggctacataaaacaaaataagcgcattacatcttccaaaattaaccttaagataacttattaactataac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47515278 |
gaacataagcaccaagtactgcctcagacaggctacataaaacaaaataagcgcattacatcttccaaaattaaccttaagataacttattaactataac |
47515377 |
T |
|
| Q |
118 |
caaagttctcttcgaaatagcaatataaaacctaaccattcacttgaaacatttaagagaacactaacagctatgctttagttcctcattcattgccatc |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47515378 |
caaagttctcttcaaaatagcaatataaaacctaaccattcacttgaaacatttaagagaacactaacagctatgctttagttcctcattcattgccatc |
47515477 |
T |
|
| Q |
218 |
tgcggcccgaagtgaacctagttgaacaggggcttgagtcgatac |
262 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47515478 |
tgcagcccgaagtgaacctagttgaacaggggcttgagtcgatac |
47515522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University