View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13067_low_25 (Length: 242)
Name: NF13067_low_25
Description: NF13067
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13067_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 4530715 - 4530927
Alignment:
| Q |
12 |
ggtggtatctgcttcattaataagtaaccaatctatgccacaaaatcttctttaatatgcaaaaaattgaaagttttatgaaatgaatttgaccctaata |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4530715 |
ggtggtatctgcttcattaataagtaaccaatctatgccacaaaatcttctttaatatgcaaaaaattgaaagttttatgaaatgaatttgaccctaata |
4530814 |
T |
|
| Q |
112 |
aacgcttttcttctttaaaagcaaatctttctaaaaatatataatgagaagcagatacacatgtaagctgagaaatctttggcatggcaatgggaaatat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4530815 |
aacgcttttcttctttaaaagcaaatctttctaaaaatatataatgagaagcagatacacatgtatgctgagaaatctttggcatggcaatgggaaatat |
4530914 |
T |
|
| Q |
212 |
gatagggacgtat |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4530915 |
gatagggacgtat |
4530927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University