View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13068_high_8 (Length: 250)
Name: NF13068_high_8
Description: NF13068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13068_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 40662285 - 40662519
Alignment:
| Q |
1 |
tgtttcaatatttgttgatatgataatcaagtccctcaactcataatttacaatcctcaaacaatagataacatttgggcacttctttgatttttcatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
40662285 |
tgtttcaatatttgttgatatgataatcaagtcgctcaactcataatttacaatccttaaacaatagataacatttgggtacttcttggaattttcatta |
40662384 |
T |
 |
| Q |
101 |
gtgtcttgcattgatcttgagttagttttgtggagtgtgaagttatattgcttgtcaataggaattactgttagtcaatgtagctaaccaatgagccatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
40662385 |
gtgtcttgcattgatcttgagttagttttgtggagtgccaagttatattgcttgtcaataggaattactattagtcaatgtagttaaccaatgagccatt |
40662484 |
T |
 |
| Q |
201 |
gacacatgtctcacacctattatccttaaaggtct |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
40662485 |
gacacatgtctcacacctattatcctcaaaggtct |
40662519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University