View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13069_high_11 (Length: 226)

Name: NF13069_high_11
Description: NF13069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13069_high_11
NF13069_high_11
[»] chr1 (2 HSPs)
chr1 (65-214)||(4092667-4092812)
chr1 (1-46)||(4092812-4092857)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 65 - 214
Target Start/End: Complemental strand, 4092812 - 4092667
Alignment:
65 gagtaacgtacgcgtgcacgggtactttaccatatttggaataccgtcccattcttcagaggtaggggccaatgtttcatagtgcagaggcttgtatgtc 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| ||||||||||||||||||||||||    
4092812 gagtaacgtacgcgtgcacgggtactttaccatatttggaatacc----cattcttcagaggtaggggccaatgtgtcatagtgcagaggcttgtatgtc 4092717  T
165 caattctggtgattgtgcaccaatttctccgcatgcatatataggtgttc 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
4092716 caattctggtgattgtgcaccaatttctccgcatgcatatataggtgttc 4092667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 4092857 - 4092812
Alignment:
1 atatactaaaatatattatccctaccgtcaacaaaattcagtcacg 46  Q
    ||||||||||||||| |||||||||| |||||||||||||||||||    
4092857 atatactaaaatatactatccctaccatcaacaaaattcagtcacg 4092812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University