View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13069_high_11 (Length: 226)
Name: NF13069_high_11
Description: NF13069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13069_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 65 - 214
Target Start/End: Complemental strand, 4092812 - 4092667
Alignment:
| Q |
65 |
gagtaacgtacgcgtgcacgggtactttaccatatttggaataccgtcccattcttcagaggtaggggccaatgtttcatagtgcagaggcttgtatgtc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4092812 |
gagtaacgtacgcgtgcacgggtactttaccatatttggaatacc----cattcttcagaggtaggggccaatgtgtcatagtgcagaggcttgtatgtc |
4092717 |
T |
 |
| Q |
165 |
caattctggtgattgtgcaccaatttctccgcatgcatatataggtgttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4092716 |
caattctggtgattgtgcaccaatttctccgcatgcatatataggtgttc |
4092667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 4092857 - 4092812
Alignment:
| Q |
1 |
atatactaaaatatattatccctaccgtcaacaaaattcagtcacg |
46 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
4092857 |
atatactaaaatatactatccctaccatcaacaaaattcagtcacg |
4092812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University