View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13069_high_9 (Length: 260)
Name: NF13069_high_9
Description: NF13069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13069_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 44802513 - 44802280
Alignment:
| Q |
1 |
tttatatgcatgtttatcttagcatcatacataaatagcatcttatgaattgaaatgaaattgaactggttgtctttatatatatatgcacatttctagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44802513 |
tttatatgcatgtttatcttagcatcatacataaatagcatcttatcaattgaaatgaaattgaactggttgtctttatat------gcacatttctagt |
44802420 |
T |
 |
| Q |
101 |
tgatgaaaattctaagatgagttttgatttaatatatcaactcnnnnnnnatgaactttgttaaatgacatgatgttgtcaaataaaattaaaggagata |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44802419 |
tgatgaaaattctaaattgagttttgatttaat----caactctttttttatgaactttgttaaatgacatgatgttgtcaaataaaattaaaggagata |
44802324 |
T |
 |
| Q |
201 |
tcagtatcagaatcaagatctactacacagttatgtaacttatg |
244 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44802323 |
tcagtatcagaatgaagatctactacacagttatgtaacttatg |
44802280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University