View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13069_low_13 (Length: 221)

Name: NF13069_low_13
Description: NF13069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13069_low_13
NF13069_low_13
[»] chr4 (1 HSPs)
chr4 (13-205)||(45650229-45650421)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 205
Target Start/End: Original strand, 45650229 - 45650421
Alignment:
13 aagaatataataaagagtgagagaaaacaaagtgaagactgaaaactacccagatggcagggaagnnnnnnnngtgtcagaaaagcacgtgatgagaatg 112  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||    
45650229 aagaaaataataaagagtgagagaaaacaaagtgaagactgaaaactacccagatggcagggaagaaaaaaaagtgtcagaaaagcacgtgatgagaatg 45650328  T
113 gatggaacaatgaagtaaaataggtgaaaatgatgatgaaagtgtcaggttgaacagaagactactaatattactagaaaacaagttgttatt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
45650329 gatggaacaatgaagtaaaataggtgaaaatgatgatgaaagtgtcaggttgaacagaagactactactattactagaaaacaagttgttatt 45650421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University