View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_high_17 (Length: 294)
Name: NF1306_high_17
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 30 - 281
Target Start/End: Complemental strand, 38073112 - 38072865
Alignment:
| Q |
30 |
acatcaaatggattgtctaatatggagtcctcataagaaaagtatgttttggatcaagattgcttatcattaattctattaggtattgagaggaatccaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38073112 |
acatcaaatggattgtctaatatggagtcctcataagaaaagtatgttttggatcaagattgcttatcattaattctattaggtattgagaggaatccaa |
38073013 |
T |
|
| Q |
130 |
tccctatcatgtttctgtttataataccaactctcagtgttggtcgaagctttaacacatgtaaatcttgtttggagaatttttctttttaattagtctt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
38073012 |
tccctatcatgtttctgtttataataccaactctcagtgttggtcgaagctttaacacatgtaaatcttgtttggagtatttttcttt----ttagtctt |
38072917 |
T |
|
| Q |
230 |
cttaccaaaaagaagtttttaataaaggaatggcgatcgaccctatttgtct |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38072916 |
cttaccaaaaagaagtttttaataaaggaatggcgattgaccctatttgtct |
38072865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University