View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_high_31 (Length: 211)
Name: NF1306_high_31
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_high_31 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 23 - 211
Target Start/End: Complemental strand, 11645072 - 11644886
Alignment:
| Q |
23 |
atgttgatttccagcaactggaacctcataggtctaaactcaaatttaaatgtagtgatttttggaatagcgatgtgtttggataaaataatacagtctc |
122 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||| |
|
|
| T |
11645072 |
atgttaatttccagcaactggaacctcctaggtctaaactcaaatttaaatgtagtgatttttgaaatagcaatgtgtttggataaaataata--gtcta |
11644975 |
T |
|
| Q |
123 |
tttgatggtcctctctttgttaccgaaatgctgccaaatcgatatggcggagttgcaatctcgcacacaattaaggaaagtctcatcat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11644974 |
tttgatggtcctctctttgttaccgaaatgctgccaaatcgatatggaggagttgcaatctcgcacacaatgaaggaaagtctcatcat |
11644886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University