View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_20 (Length: 324)
Name: NF1306_low_20
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 80 - 252
Target Start/End: Original strand, 36227031 - 36227203
Alignment:
| Q |
80 |
tggcttcaaatattgaattacttcggaggggtttatcggcgaattccgggtattcaatctcttttttcgggctttgccgggctcttccctttcctttgat |
179 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36227031 |
tggcttcaaatattgaattacttcagaggggtttatcggcaaattccgagtattcaatctcttttttcgggctttgtcgggctcttccctttcctttgat |
36227130 |
T |
|
| Q |
180 |
aaatttcctcctacaagctcttgaaagtctttgactaagccttcttcccgctctactggaaactttccaatat |
252 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36227131 |
aaatttccccctacaagctcttgaaagtctttgactaagccttcttcccgctctactggaaactttccaatat |
36227203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University