View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_22 (Length: 317)
Name: NF1306_low_22
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 96 - 263
Target Start/End: Original strand, 42394865 - 42395034
Alignment:
| Q |
96 |
atgtgtttgagaattcgtgttgaagatatatattaaggaaacggccagcaatattggaatgggaataatgcaaaaacgacgaatgtgcacgcac--atgg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||| ||| ||| |
|
|
| T |
42394865 |
atgtgtttgagaattcgtgttgaagatatatattaagggaacggccagcaatattggaatgagaataatgcaaaaacgacaaatgtgcacacacatatga |
42394964 |
T |
|
| Q |
194 |
atattttgcatggagggcggacgggaatgaaggaatatattatgcggtcacagccatttatagataattt |
263 |
Q |
| |
|
||||||||||||||||||||||| || ||| |||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
42394965 |
atattttgcatggagggcggacgagagtgagggaatatattatacggtaacagccatttatagaaaattt |
42395034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 262 - 312
Target Start/End: Original strand, 42395513 - 42395562
Alignment:
| Q |
262 |
ttagtgtttttcaataaaatgtgatatcactttattaaatacatatgtaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42395513 |
ttagtgtttttcaataaaatgtgatactactttatt-aatacatatgtaaa |
42395562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University