View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_24 (Length: 315)
Name: NF1306_low_24
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 87 - 209
Target Start/End: Complemental strand, 37248974 - 37248852
Alignment:
| Q |
87 |
cagaccggcatgatatggttgttaatttctttgactaaattaaactcatttcaagaggaaacaataacacagttagataagatttgacccaaactaaaac |
186 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37248974 |
cagaccggcatgatgtggatgttaatttctttgactaaattaaactcatttcaagaggaaacaataacacagttagataagatttgacccaaactaaaac |
37248875 |
T |
 |
| Q |
187 |
atttcattaattaaactgatgat |
209 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37248874 |
atttcattaattaaactgatgat |
37248852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University