View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_27 (Length: 295)
Name: NF1306_low_27
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 54 - 241
Target Start/End: Original strand, 31870722 - 31870909
Alignment:
| Q |
54 |
tcatccttagcaagcggccattgaatctcattgccgacacgagcgtaaacagctacggtgttattcccctgccggagacgaatgatggtgagatcaccga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31870722 |
tcatccttagcaagcggccattgaatctcattgccgacacgagcgtaaacagctacggtgttattcccctgccggagacgaatgatggtgagatcactga |
31870821 |
T |
|
| Q |
154 |
tagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgatgaggatatcttctgcggcgatctgtgg |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870822 |
tagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgatgaggatatcttctgcggcgatctgtgg |
31870909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 8851051 - 8850963
Alignment:
| Q |
126 |
cggagacgaatgatggtgagatcaccgatagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgat |
214 |
Q |
| |
|
|||||||| | || ||||| |||||| ||||||||| | ||||||||||||||| || |||| |||||||| |||||||||||||| |
|
|
| T |
8851051 |
cggagacggacgacggtgaagtcaccggaagcaagttcaacgctgtattgttgatcgatgaggttgagaatggctccggggattttgat |
8850963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University