View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_34 (Length: 274)
Name: NF1306_low_34
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 22198419 - 22198268
Alignment:
| Q |
1 |
gcggcaataacgatctcttcttcatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgagatgaaaaaacgagatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22198419 |
gcggcaataacgatctcttcttcatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtgaaaaaacgagatc |
22198320 |
T |
 |
| Q |
101 |
aatagagaaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
22198319 |
aatagagaaaaatatgtgatgggtttacgatttatgagaaggttctgtggtg |
22198268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 6814366 - 6814227
Alignment:
| Q |
1 |
gcggcaataacgatctcttcttcatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgagatgaaaaaacgagatc |
100 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||||||||||| ||||| ||||| ||| ||| |||||| ||||||||||| || |
|
|
| T |
6814366 |
gcggcagtaacgatctcttcttcattgtgagtttgatggagagatg------------gagagtgagaaagagggaaaggtgaggtgaaaaaacgatttc |
6814279 |
T |
 |
| Q |
101 |
aatagagaaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg |
152 |
Q |
| |
|
||| ||||| |||||||||||||| | | ||||||||| ||||| ||||||| |
|
|
| T |
6814278 |
aattgagaagaatatgtgatgggtatgcgatttatgagaaggttttgtggtg |
6814227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University