View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_35 (Length: 273)
Name: NF1306_low_35
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 22198419 - 22198268
Alignment:
| Q |
1 |
gcggaaataacgatctcttcttgatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtga-aaaacgagatc |
99 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22198419 |
gcggcaataacgatctcttcttcatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtgaaaaaacgagatc |
22198320 |
T |
 |
| Q |
100 |
aatagagaaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
22198319 |
aatagagaaaaatatgtgatgggtttacgatttatgagaaggttctgtggtg |
22198268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 25 - 132
Target Start/End: Complemental strand, 6098146 - 6098033
Alignment:
| Q |
25 |
tcgtgagtttgatggagagatggattgaggtggtgag------agggagaacgagtgaacggtgaggtgaaaaacgagatcaatagagaaaaatatgtga |
118 |
Q |
| |
|
|||||||||||||||| ||||||||| || ||||||| || ||||||||||||| ||||||||||||||||| ||||| ||||| ||| ||||| |
|
|
| T |
6098146 |
tcgtgagtttgatggaaagatggattaagatggtgagtgaggaagtgagaacgagtgaaaagtgaggtgaaaaacgagttcaattgagaagaatttgtga |
6098047 |
T |
 |
| Q |
119 |
tgggtttaccattt |
132 |
Q |
| |
|
||||| ||| |||| |
|
|
| T |
6098046 |
tgggtatacgattt |
6098033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 151
Target Start/End: Complemental strand, 6814359 - 6814227
Alignment:
| Q |
8 |
taacgatctcttcttgatcgtgagtttgatggagagatggattgaggtggtgagagggagaacgagtgaacggtgaggtgaaaaa-cgagatcaatagag |
106 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||| ||||| ||| ||| |||||||||||||| ||| ||||| ||| |
|
|
| T |
6814359 |
taacgatctcttcttcattgtgagtttgatggagagatgga------------gagtgagaaagagggaaaggtgaggtgaaaaaacgatttcaattgag |
6814272 |
T |
 |
| Q |
107 |
aaaaatatgtgatgggtttaccatttatgagtaggttctgtggtg |
151 |
Q |
| |
|
|| |||||||||||||| | | ||||||||| ||||| ||||||| |
|
|
| T |
6814271 |
aagaatatgtgatgggtatgcgatttatgagaaggttttgtggtg |
6814227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University