View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_39 (Length: 251)
Name: NF1306_low_39
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_39 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 29946122 - 29946351
Alignment:
| Q |
23 |
atcatcatatccataccttctcaagaacatgggttcgggatagtgaactaagctggctgctttccatatttgcaagtaactgaacgacagtcttcagctg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29946122 |
atcatcatatccataccttctcaagaacatgggttcgggatagtgaactaagctggctactttccatatttgcaagtaactgaacgacagtcttcagctg |
29946221 |
T |
 |
| Q |
123 |
tggaacactacaaattcggaactcaaatcagcaatatat-aaaaacatatcctacactgatacaaagttaaaagaaaataactgcagcgacttcgaatca |
221 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29946222 |
tggaacactacaaattttgaactcaaatcagcaatatataaaaaacatatcctacactgatacaaagttaaaagaaaataactgcagcgacttcgaatca |
29946321 |
T |
 |
| Q |
222 |
atgttgtcaaaatagcggctatagcttaac |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29946322 |
atgttgtcaaaatagcggctatagcttaac |
29946351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University