View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1306_low_40 (Length: 251)

Name: NF1306_low_40
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1306_low_40
NF1306_low_40
[»] chr6 (1 HSPs)
chr6 (1-37)||(23119016-23119052)


Alignment Details
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 23119016 - 23119052
Alignment:
1 ccttttcttatatttatcagggggaatagaagtattt 37  Q
    |||||||||||||||||||||||||||||||||||||    
23119016 ccttttcttatatttatcagggggaatagaagtattt 23119052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University