View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_47 (Length: 221)
Name: NF1306_low_47
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 57 - 206
Target Start/End: Original strand, 34014419 - 34014568
Alignment:
| Q |
57 |
cacagaagcaaggtctacatgtttagctagtgctgataactatgaatttggagtttatgaatggagtgttcaacttgttacaaataatagtcgaattgaa |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34014419 |
cacagaagcaaggtctacatgtttagctagtgctgataactatgaatttggagtttatgaatggagtgttcaacttgttacaaataatagtcgaattgaa |
34014518 |
T |
|
| Q |
157 |
aagatactccttcctatcttttggggcctaatgactctcaggtattttct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34014519 |
aagatactccttcctatcttttggggcctaatgactctcaggtattttct |
34014568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University