View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_50 (Length: 220)
Name: NF1306_low_50
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 2753467 - 2753292
Alignment:
| Q |
1 |
atcattcccatgattattattttacttcaaatgtttcttgttttttatatcaattaatttgtggatttcagaataaacaaaagaagatgatggcaatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2753467 |
atcattcccatgattattattttacttcaaatgtttcttgttttttatatcaataaatttctggatttcagaataaacaaaagaagatgatggcaatcaa |
2753368 |
T |
 |
| Q |
101 |
atgactagctcatattggtggaaaactggaaatgtaaattatattcagcagggtgaactttatgtacctatatttt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2753367 |
atgactagctcatattggtggaaaactggaaatgtaaattatattcagcagggtgaactttatgtacctatatttt |
2753292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 209
Target Start/End: Original strand, 7109095 - 7109135
Alignment:
| Q |
169 |
tatatttttaaacttgaagttatctaaagctataggcctat |
209 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7109095 |
tataattttaaacttgaagttatctaaagctataggtctat |
7109135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University