View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_56 (Length: 203)
Name: NF1306_low_56
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 57 - 133
Target Start/End: Original strand, 48569141 - 48569217
Alignment:
| Q |
57 |
gaaatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacctattttgttggagatgc |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
48569141 |
gaaatcttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacctttttggttggaaatgc |
48569217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 63 - 133
Target Start/End: Complemental strand, 10821937 - 10821867
Alignment:
| Q |
63 |
ttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacctattttgttggagatgc |
133 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| |||||||||| || ||||| |||||||| ||| |||| |
|
|
| T |
10821937 |
ttgcagtgtgcagaatctgccttgaaatcagtcttaggagatctttcgaatacatattttgtcggaaatgc |
10821867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 133
Target Start/End: Original strand, 36145449 - 36145519
Alignment:
| Q |
63 |
ttgcagtgtgctgagtctgcattgaaatcagtcataggagatctctccaatacctattttgttggagatgc |
133 |
Q |
| |
|
||||||||||| || ||||| |||||||||||| | |||||||| || ||||| |||||||| ||| |||| |
|
|
| T |
36145449 |
ttgcagtgtgcagaatctgccttgaaatcagtcttgggagatctttcaaatacatattttgtcggaaatgc |
36145519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University