View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1306_low_58 (Length: 201)
Name: NF1306_low_58
Description: NF1306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1306_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 4048609 - 4048720
Alignment:
| Q |
13 |
gtagtgggaaaagaaaaagaatagtgttggtctttctttctttagttgttctccgtctacctctcgtcgttgtcgatgttgttgtttgtcgttgtccatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048609 |
gtagtgggaaaagaaaaagaatagtgttggtctttctttcattagttgttctccgtctacctctcgtcgttgtcgatgttgttgtttgtcgttgtccatg |
4048708 |
T |
 |
| Q |
113 |
tctgtggtgctg |
124 |
Q |
| |
|
||| || ||||| |
|
|
| T |
4048709 |
tctttgttgctg |
4048720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University