View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307-Insertion-1 (Length: 290)
Name: NF1307-Insertion-1
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307-Insertion-1 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 24 - 290
Target Start/End: Original strand, 6916699 - 6916963
Alignment:
| Q |
24 |
gggtcaacaaaattttgaaagcaaataaaaagtagctataattgtgatagtgtacaatttggtgtcactccaatgtttttattgggaaacttgatttaat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916699 |
gggtcaacaaaattttgaaagcaaataaaaagtagctataattgtgatagtgtacaatttggtgtcactccaatgtttttattgggaaacttgatttaac |
6916798 |
T |
 |
| Q |
124 |
attaaatttatcatatatttgcgttttcttatattttagttgacacatacatgctcattttcaattctatcatacattgttcagctagtttagatttttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916799 |
attaaatttatcatatatttgcgttttcttatattttagttgacacatacatgctcattttcaattctatcatacattgttcagctagtttagatttttg |
6916898 |
T |
 |
| Q |
224 |
ttcacttatcaatgcacttccgactgtaaatctgtgatgaggtgataatcatggcaggcttcttgta |
290 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6916899 |
ttcacttatcaatgcacttctgactgtaaa--tgtgatgaggtgataatcatggcaggcttcttgta |
6916963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 203 - 290
Target Start/End: Original strand, 6890644 - 6890723
Alignment:
| Q |
203 |
ttcagctagtttagatttttgttcacttatcaatgcacttccgactgtaaatctgtgatgaggtgataatcatggcaggcttcttgta |
290 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||| ||||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
6890644 |
ttcagctagtttagattttggttcacttgtcaatgtacttctgactgta--------atgaggtgatattcatggcaggcttcttgta |
6890723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University