View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1307-Insertion-3 (Length: 145)
Name: NF1307-Insertion-3
Description: NF1307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1307-Insertion-3 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 10 - 145
Target Start/End: Original strand, 30599816 - 30599951
Alignment:
| Q |
10 |
taggtgtctaaagaggaaatcccacccaagaattgtatgacgagtgcagaaacgagtctcctaaatccaacggagacaatttagttcattgaagctatag |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30599816 |
taggtgtctaaagaggaaatcccacccaagaattgtatgacgagtgcagaaacgagtctcctaaatccaacggagacaatttagttcattgaagctacag |
30599915 |
T |
|
| Q |
110 |
ttctttaaaaagttggaatttttaatgctattgtag |
145 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30599916 |
ttctttaaaaagttggaattgttaatgctattgtag |
30599951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University