View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13070_high_18 (Length: 264)
Name: NF13070_high_18
Description: NF13070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13070_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 49135502 - 49135670
Alignment:
| Q |
1 |
tataaaatatgatttctatgagtgagttata-ccgaatgagagtcaacgattgaaggtttgtggaccttgaggaagtatttgagt-agttgtgtgaaatc |
98 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49135502 |
tataaaatatgatttctaggagtgagttataaccgaatgagagtcaacgattgaaggtttgtggaccttgaggaagtatttgagttagttgtgtgaaatc |
49135601 |
T |
 |
| Q |
99 |
tcacgatgagcttgaagatagttcctttgtgatgtgctaatcaaagaacaaacacaactatctgaacaa |
167 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49135602 |
tcacgaagagcttgaagatagttcctttgtgatgtggtaatcaaagaacaaacacaactatctgaacaa |
49135670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University