View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13070_high_19 (Length: 245)

Name: NF13070_high_19
Description: NF13070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13070_high_19
NF13070_high_19
[»] chr4 (2 HSPs)
chr4 (1-91)||(49135317-49135407)
chr4 (191-229)||(49135237-49135275)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 49135407 - 49135317
Alignment:
1 gatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgagaagaggagttagtggaggattgtacgta 91  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49135407 gatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgagaagaggagttagtggaggattgtacgta 49135317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 191 - 229
Target Start/End: Complemental strand, 49135275 - 49135237
Alignment:
191 ctggtgcgtattcagttaaggtcaaggatgtcttccatt 229  Q
    |||||||||||||||||||||||||||||||||||||||    
49135275 ctggtgcgtattcagttaaggtcaaggatgtcttccatt 49135237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University