View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13070_high_21 (Length: 230)
Name: NF13070_high_21
Description: NF13070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13070_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 84 - 209
Target Start/End: Original strand, 39612697 - 39612822
Alignment:
| Q |
84 |
taggtgctgtatatcttccttaaaacagcttccctatgacaaaggacagtgcggtcagactgtaatataccatgcaaggtgtcaatagataatgtgctat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39612697 |
taggtgctgtatatcttccttaaaacagcttccctatgacaaaggacagtgcggtcagactgtaatataccatgcaaggtgtcaatagataatgtgctat |
39612796 |
T |
|
| Q |
184 |
aacatgaaaaatttattattgtatgt |
209 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
39612797 |
aacatgaaacatttattattgtatgt |
39612822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University