View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13070_low_21 (Length: 245)
Name: NF13070_low_21
Description: NF13070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13070_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 49135407 - 49135317
Alignment:
| Q |
1 |
gatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgagaagaggagttagtggaggattgtacgta |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49135407 |
gatgtgttcatttcgggttttagcaagggtgggacgggtggaggtgtagtctatttcagtgagaagaggagttagtggaggattgtacgta |
49135317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 191 - 229
Target Start/End: Complemental strand, 49135275 - 49135237
Alignment:
| Q |
191 |
ctggtgcgtattcagttaaggtcaaggatgtcttccatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49135275 |
ctggtgcgtattcagttaaggtcaaggatgtcttccatt |
49135237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University