View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13071_low_8 (Length: 335)
Name: NF13071_low_8
Description: NF13071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13071_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 12 - 326
Target Start/End: Complemental strand, 3300090 - 3299776
Alignment:
| Q |
12 |
tcatcatcggtaaccgttaaaattcacaacaaggttttgtattggatgcagctagctgaagttgacgtcggcatcaagtatcgtgggcataaacttggtc |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3300090 |
tcattatcggtaaccgttaaaattcacaacaaggttttgtattggatggagctagctgaagttgacgtcggcatcaagtatcgtgggcataaacttggtc |
3299991 |
T |
|
| Q |
112 |
acgtggaaacgaggggttggcacgtgaagggatggggttcagaacatgtgtttggtgagcttgagtttgggggacttccttctccagatgtggcacattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3299990 |
acgtggaaacgaggggttggcacgtgaagggatggggttcagaacatgtgtttggtgagcttgagtttgggggacttccttctccagatgtggcacattt |
3299891 |
T |
|
| Q |
212 |
gatgcaggatctggctaagaagagggttcattttcacactgctgttggagttgtgggaaaccttggactttttgcctttcacttccctaaaattttcaag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3299890 |
gatgcaggatctggctaagaagagggttcattttcacactgctgttggagttgtgggaaaccttggactttttgcctttcacttccctaaaattttcaag |
3299791 |
T |
|
| Q |
312 |
gtattatagtattat |
326 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3299790 |
gtattatagtattat |
3299776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University