View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13073_high_5 (Length: 317)
Name: NF13073_high_5
Description: NF13073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13073_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 2 - 165
Target Start/End: Complemental strand, 25881622 - 25881459
Alignment:
| Q |
2 |
agtccaataccgacgacacgggagtcaggctccccggagatgttggagcagctaatgccggaccagtgacagggtgtaaggtcgttttcgttccagtcgg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25881622 |
agtccaataccgacgacacgggagtcaggctccccggagatgttggagcagctaatgccggaccagtgacagggtgtaaggtcgttttcgttccagtcgg |
25881523 |
T |
|
| Q |
102 |
agaatgtagttgcggtgtcgccgccgtcgacggcggatttgagtgtcagaagagcgaggccgtc |
165 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
25881522 |
agaatgtagttgcggtgtcaccgccgtcgacggcggatttgagtgttagaagagcgaggccgtc |
25881459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 225 - 301
Target Start/End: Complemental strand, 25881399 - 25881313
Alignment:
| Q |
225 |
taatttgcatttagaatttgaagtacgacgccgttttgggtt----------gagttaagtacggtacggtgagttcagttgagttc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25881399 |
taatttgcatttagaatttgaagtacgacgccgttttgggttgtgttggttagagttaagtacggtacggtgagttcagttgagttc |
25881313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University