View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13073_high_6 (Length: 303)
Name: NF13073_high_6
Description: NF13073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13073_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 10438266 - 10437975
Alignment:
| Q |
1 |
attttttcacaaaacagattgtcatggaacttccggttgaacacggcttacttttggacaaccttttggatcttgcgcacgccccttttactcatacttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10438266 |
attttttcacaaaacagattgtcatggaacttccggttgaacacggcttacttttggacaaccttttggatcttgcgcacgccccttttactcatacttc |
10438167 |
T |
 |
| Q |
101 |
aacatttgctaagggatggagtgttcccaggtttgtatcgtttaataccctttaaagtgatatgattcaatatgtgaaaatgaaattgatttaagttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10438166 |
aacatttgctaagggatggagtgttcccaggtttgtatcgttta-taccctttaaagtgatatgattcaatatgtgaaaatgaaattgatttaagttctt |
10438068 |
T |
 |
| Q |
201 |
caaaatagccaatttgttataacaaactcttagaagcctttttcttttgacaacattatggtaaatgtattgcagtgctatgttttttctgtg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10438067 |
caaaatagccaatttgttataacaaactcttagaagcctttttcttttgacaacattatggtaaatgtattgcagtgctatgttttttctgtg |
10437975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University