View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13074_high_1 (Length: 571)
Name: NF13074_high_1
Description: NF13074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13074_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 366; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 13 - 402
Target Start/End: Original strand, 15600373 - 15600762
Alignment:
| Q |
13 |
aatatccccattctcaacttcattactccgtcgtggtggtgacagtgatggtgatggtggagggcccagcttctcagacacaatttcaccattctcaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15600373 |
aatatccccattctcaacttcattactccgtcgtggtggtgacagtgatggtgatggtggagggcccagcttctcagacacaatttcaccattctcaatt |
15600472 |
T |
|
| Q |
113 |
tcattaatctgctgtgacggcttctcagacacaaactcacccttttcaatttcattattccgcggtggcagcgacagcttcacagaaacaaactcgccat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15600473 |
tcattaatctgctgtgacggcttctcagacacaaactcacccttttcaatttcattattccgcggtggcagcgacggcttcacagaaacaaactcgccat |
15600572 |
T |
|
| Q |
213 |
tttcaatttcattactctgcggtggcagtggcagcggcaacttctcaaactcaaactccccattctcgagtccactccccggccatgacaaagtccccaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15600573 |
tttcaatttcattactctgcggtggcagtggcagcggcggcttctcaaactcaaactccccattctcgagtccactccccggccacgacaaagtccccaa |
15600672 |
T |
|
| Q |
313 |
ttcaccctcttccacttcatcatccacctgcccgcatatttcgccactcttaacaacaccaccattactacccactccacccaacgccaa |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15600673 |
ttcaccctcttccacttcatcatccacctgcccgcaaatttcgccactcttaacaacaacaccattactacccactccacccaacgccaa |
15600762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 524 - 552
Target Start/End: Original strand, 15600884 - 15600912
Alignment:
| Q |
524 |
aaaccattctcactcttccctccacaact |
552 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15600884 |
aaaccattctcactcttccctccacaact |
15600912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University