View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13074_low_3 (Length: 485)
Name: NF13074_low_3
Description: NF13074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13074_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 8e-53; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 19 - 136
Target Start/End: Original strand, 31883991 - 31884108
Alignment:
| Q |
19 |
gttttgtggatggttggactggatggatgactcctttgtccatccaaacattcttttgttagagagtatcaaagattttggaggggtattcgaaacactt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31883991 |
gttttgtggatggttggactggatggatgactcccttgtccatccaaacattcttttgttagagagtataaaagattttggaggggtattcgaaacactt |
31884090 |
T |
 |
| Q |
119 |
atacactcacttttgaag |
136 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
31884091 |
atacaatcacttttgaag |
31884108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 152 - 219
Target Start/End: Original strand, 9069523 - 9069592
Alignment:
| Q |
152 |
aaatgataaatggacacaaatttgttcacacaaatacaacaccg--tatttactattcataaatactcca |
219 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| ||| ||| |||| ||||||||||||||| |
|
|
| T |
9069523 |
aaatgataaacaaacacaaatttgttgacacaaatacaactccgtatatgtactgttcataaatactcca |
9069592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 139 - 198
Target Start/End: Complemental strand, 14245327 - 14245268
Alignment:
| Q |
139 |
ttttattttagagaaatgataaatggacacaaatttgttcacacaaatacaacaccgtat |
198 |
Q |
| |
|
||||| ||||||| | |||||| ||||||||||| | || |||||||||||||||||||| |
|
|
| T |
14245327 |
ttttaatttagagtattgataactggacacaaatctcttgacacaaatacaacaccgtat |
14245268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University