View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13075_high_31 (Length: 204)
Name: NF13075_high_31
Description: NF13075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13075_high_31 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 157 - 204
Target Start/End: Original strand, 42204888 - 42204935
Alignment:
| Q |
157 |
aatgaatgatgaatcgccgtatcggatgtgtattgtatctgatactcg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42204888 |
aatgaatgatgaatcgccgtatcggatgtgtattgtatctgatactcg |
42204935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 42204732 - 42204764
Alignment:
| Q |
1 |
ttaaaaattgtgtactgagtttggaagataatg |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42204732 |
ttaaaaattgtgtactgagtttggaagataatg |
42204764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University