View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13075_low_19 (Length: 352)
Name: NF13075_low_19
Description: NF13075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13075_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 2 - 314
Target Start/End: Original strand, 8085158 - 8085490
Alignment:
| Q |
2 |
gaggaggagcagagacgacggtctagggttagggttaggtatggttccgaattgagctacagggattacgaggatgagctggannnnnnnngaatcggag |
101 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8085158 |
gaggagcagcagcgacgacggtctagggttagggttaggtatggttccgaattgagctacagggattacgaggatgagctggattttttt-gaatcggag |
8085256 |
T |
|
| Q |
102 |
gtatcaaacgatggacgtgttattctgcagtacgcacgtccaggtcgttctacggtcaatcatcaccatcgtgaggaagtagctccatggcagcgttatg |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8085257 |
gtatcgaacgatggacgtgttattctgcagtacgcacgtccaggtcgttctacggtcaatcatcaccatcgtgaggaagtagctccatggcagcgttatg |
8085356 |
T |
|
| Q |
202 |
ct---------------------tcacgtccgaaacagcagaaggaaatcgctttctattctggtgaagttgcgcgaccttttcttgatgtgcagaggcc |
280 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8085357 |
cttcacgtcctggccatttctcatcacgtccgaaacagcagaaggaaatcgctttctattctggtgaagctgcgcgaccttttcttgatgtgcaaaggcc |
8085456 |
T |
|
| Q |
281 |
taaaacgcatcaacatgaggaggtctctcttgat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8085457 |
taaaacgcatcaacatgaggaggtctctcttgat |
8085490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University