View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13075_low_28 (Length: 250)
Name: NF13075_low_28
Description: NF13075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13075_low_28 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 103 - 250
Target Start/End: Complemental strand, 7727905 - 7727758
Alignment:
| Q |
103 |
tttttgttcccttctctttaatgatatattgtggtagcagccctttactccacatatacctccctagacgtcaatgtatatatggttggatgcattcaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7727905 |
tttttgttcccttctctttaatgatatattgtggtagcagccctttactccacatacacctccctagacgtcaatgtatatatggttggatgcattcaaa |
7727806 |
T |
 |
| Q |
203 |
gggtcttatctcattattttaagcctttctgtttgaccaactttcact |
250 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7727805 |
gggtcatatctcattattttaagcctttctgtttgaccaactttcact |
7727758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 16 - 111
Target Start/End: Complemental strand, 7728184 - 7728089
Alignment:
| Q |
16 |
aagagaatattatgtaaagaatagacttggtgcctaactataggtttatcaattcctaggaggttgcgcctttatgtcccctcgttatttttgttc |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7728184 |
aagagaatactatgtaaagaatagacttggtgcctaactataggtttatcaattcctaggaggttgcggctttatgtcccctcgttatttttgttc |
7728089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 7740106 - 7740065
Alignment:
| Q |
209 |
tatctcattattttaagcctttctgtttgaccaactttcact |
250 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7740106 |
tatctcattattttaagcctacttgtttgaccaactttcact |
7740065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 3562389 - 3562324
Alignment:
| Q |
17 |
agagaatattatgtaaagaatagacttgg--tgcctaactataggtttatcaattcctaggaggtt |
80 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| | |||||||||||| | |||||||||| |
|
|
| T |
3562389 |
agagaatattatgttaagaatagacttggtatgcctaattttaggtttatcaacttctaggaggtt |
3562324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 69
Target Start/End: Complemental strand, 9748946 - 9748892
Alignment:
| Q |
17 |
agagaatattatgtaaagaatagacttgg--tgcctaactataggtttatcaatt |
69 |
Q |
| |
|
|||||||||||||| ||||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
9748946 |
agagaatattatgttaagaatagactaggtatgcctaactttaggtttatcaatt |
9748892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 80
Target Start/End: Complemental strand, 34066119 - 34066064
Alignment:
| Q |
27 |
atgtaaagaatagacttgg--tgcctaactataggtttatcaattcctaggaggtt |
80 |
Q |
| |
|
|||| |||||||||||||| ||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
34066119 |
atgttaagaatagacttggtatgcctaattataggtttagcaatttctaggaggtt |
34066064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University